Test for androgen receptor CAG repeat length

ResearchIt

Active Member
Has anyone found a clinic that does the test for androgen receptor CAG repeat length?

The androgen receptor CAG repeat length is mentioned in many studies on PubMed, but I can't find any information on how to get the test done for an individual.
 
"Analysis of CAG-Repeat Lengths
DNA was extracted from EDTA blood samples using FlexiGene (Qiagen, Hilden, Germany) according to standard procedures. PCR primers (forward: gccgccgtccaagacctaccgag; reverse: cggctgtgaaggttgctgttcc) were designed flanking the poly-glutamine region downstream Lysine at position 57 in exon 1 of the AR (NM_000044.6). The resulting PCR products were purified (QIAquick; Qiagen, Hilden, Germany) and sequenced using nested primers (forward: aagtgatccagaacccggg; reverse: ctcatccaggaccaggtagc) and Brilliant Dye 1.1 (NimaGen, Nijmegen, Netherlands) on a 3130 XL Genetic Analyzer (Thermo Fisher Scientific, Waltham, USA) according to the manufacturer's recommendations. The number of CAG repeats was counted independently by two investigators using CodonCode Aligner (CodonCode Cooperation, Centerville, MA, USA) for display."

 
I don't think there is a commercially available test for AR CAG repeat length yet.
Thank you for the feedback. It would be interesting to get one.

Have you encountered any special university labs or specialty clinics in the US that cater to non-commercially available type tests for a fee?
 

hCG Mixing Calculator

HCG Mixing Protocol Calculator

Online statistics

Members online
6
Guests online
428
Total visitors
434

Latest posts

Back
Top