Test for androgen receptor CAG repeat length

[ResearchIt]

Has anyone found a clinic that does the test for androgen receptor CAG repeat length?

The androgen receptor CAG repeat length is mentioned in many studies on PubMed, but I can't find any information on how to get the test done for an individual.

 

[Nelson Vergel]

I don't think there is a commercially available test for AR CAG repeat length yet.

 

[Nelson Vergel]

"Analysis of CAG-Repeat Lengths
DNA was extracted from EDTA blood samples using FlexiGene (Qiagen, Hilden, Germany) according to standard procedures. PCR primers (forward: gccgccgtccaagacctaccgag; reverse: cggctgtgaaggttgctgttcc) were designed flanking the poly-glutamine region downstream Lysine at position 57 in exon 1 of the AR (NM_000044.6). The resulting PCR products were purified (QIAquick; Qiagen, Hilden, Germany) and sequenced using nested primers (forward: aagtgatccagaacccggg; reverse: ctcatccaggaccaggtagc) and Brilliant Dye 1.1 (NimaGen, Nijmegen, Netherlands) on a 3130 XL Genetic Analyzer (Thermo Fisher Scientific, Waltham, USA) according to the manufacturer's recommendations. The number of CAG repeats was counted independently by two investigators using CodonCode Aligner (CodonCode Cooperation, Centerville, MA, USA) for display."

Frontiers | Size Matters: The CAG Repeat Length of the Androgen Receptor Gene, Testosterone, and Male Adolescent Depression Severity

There is a distinct increase in the prevalence of depression with the onset of puberty. The role of peripubertal testosterone levels in boys in this context ...

www.frontiersin.org

 

[Nelson Vergel]

Men's Response to Testosterone Depends on their CAG Repeats in Their AR Gene.

Androgen Sensitivity: Beyond the Well-Known © Irina A. Khripun*, Sergey V. Vorobyev Rostov State Medical University, Rostov-on-Don, Russia The gonadal and extragonadal effects of testosterone in men have been actively studied in recent years. To date there is no doubt an increased risk of...

www.excelmale.com

 

[ResearchIt]

I don't think there is a commercially available test for AR CAG repeat length yet.

Thank you for the feedback. It would be interesting to get one.

Have you encountered any special university labs or specialty clinics in the US that cater to non-commercially available type tests for a fee?