Test for androgen receptor CAG repeat length

ResearchIt

Active Member
Has anyone found a clinic that does the test for androgen receptor CAG repeat length?

The androgen receptor CAG repeat length is mentioned in many studies on PubMed, but I can't find any information on how to get the test done for an individual.
 
"Analysis of CAG-Repeat Lengths
DNA was extracted from EDTA blood samples using FlexiGene (Qiagen, Hilden, Germany) according to standard procedures. PCR primers (forward: gccgccgtccaagacctaccgag; reverse: cggctgtgaaggttgctgttcc) were designed flanking the poly-glutamine region downstream Lysine at position 57 in exon 1 of the AR (NM_000044.6). The resulting PCR products were purified (QIAquick; Qiagen, Hilden, Germany) and sequenced using nested primers (forward: aagtgatccagaacccggg; reverse: ctcatccaggaccaggtagc) and Brilliant Dye 1.1 (NimaGen, Nijmegen, Netherlands) on a 3130 XL Genetic Analyzer (Thermo Fisher Scientific, Waltham, USA) according to the manufacturer's recommendations. The number of CAG repeats was counted independently by two investigators using CodonCode Aligner (CodonCode Cooperation, Centerville, MA, USA) for display."

 
I don't think there is a commercially available test for AR CAG repeat length yet.
Thank you for the feedback. It would be interesting to get one.

Have you encountered any special university labs or specialty clinics in the US that cater to non-commercially available type tests for a fee?
 

hCG Mixing Calculator

HCG Mixing Protocol Calculator

TRT Hormone Predictor Widget

TRT Hormone Predictor

Predict estradiol, DHT, and free testosterone levels based on total testosterone

⚠️ Medical Disclaimer

This tool provides predictions based on statistical models and should NOT replace professional medical advice. Always consult with your healthcare provider before making any changes to your TRT protocol.

ℹ️ Input Parameters

Normal range: 300-1000 ng/dL

Predicted Hormone Levels

Enter your total testosterone value to see predictions

Results will appear here after calculation

Understanding Your Hormones

Estradiol (E2)

A form of estrogen produced from testosterone. Important for bone health, mood, and libido. Too high can cause side effects; too low can affect well-being.

DHT

Dihydrotestosterone is a potent androgen derived from testosterone. Affects hair growth, prostate health, and masculinization effects.

Free Testosterone

The biologically active form of testosterone not bound to proteins. Directly available for cellular uptake and biological effects.

Scientific Reference

Lakshman KM, Kaplan B, Travison TG, Basaria S, Knapp PE, Singh AB, LaValley MP, Mazer NA, Bhasin S. The effects of injected testosterone dose and age on the conversion of testosterone to estradiol and dihydrotestosterone in young and older men. J Clin Endocrinol Metab. 2010 Aug;95(8):3955-64.

DOI: 10.1210/jc.2010-0102 | PMID: 20534765 | PMCID: PMC2913038

Beyond Testosterone Podcast

Online statistics

Members online
6
Guests online
628
Total visitors
634

Latest posts

Back
Top